Construction of Recombinant Lentiviral Vector Mediated mTnfaip8 gene silencing

• 1、The Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Key Laboratory of Translational Cardiovascular Medicine, Qilu Hospital of Shandong University

Abstract：Aim: To construct recombinant lentiviral vector mediated mouse tumor-necrosis-factor alpha induced protein 8(mTnfaip8) gene silencing and establish mouse smooth muscle cell line MOVAS with stable knockdowan of mTnfaip8 expression. Method: mTnfaip8 mRNA sequence was picked from NCBI database, 4 target sequences were selected using Ambion software. 4 shRNAs were synthesized correspondly and ligated into GV115 lentiviral vector to generate recombinatnt lentival plasmids. Then the four recombinant plasmids were transfected into MOVAS cells, RNA was extracted to check the expression of mTnfaip8 by RT-qPCR. The plasmid with the best silencing effect was packaged to generate lentivirus(designated as LV-T8KD)in HEK293T cells, and the virus titer was determined. MOVAS cells were infected with LV-T8KD, RT-qPCR and Western Blot was performed to detect the expression of mTnfaip8. Result: The shRNAconstructs were confirmed by sequencing.The qPCR results showed the shRNA targeting GCCTTGTACAATCCCTTTGGA had the best silencing effect. The titre of lentivirus LV-T8KD was about 6×108 cfu/ml。After the infection of LV-T8KD, we observed highly efficient transduction (> 90 %) of lentivirus in MOVAS cells by fluorescent microscopy. both RT-qPCR and Western Blot showed dramatic downregulation of mTnfaip8 in LV-T8KD infected MOVAS.Conclusion: We successfully construced the lentiviral vector mediated mouse tumor-necrosis-factor alpha induced protein 8(mTnfaip8) gene silencing and established mouse smooth muscle cell line MOVAS with stable knockdowan of mTnfaip8 expression, which would greatly facilitate our further study of Tnfaip8 in smooth musle cells.

Keywords： Gene silencing Tnfaip8 Lentivirus Smooth muscle cell